Which one is the correct product of DNA dependent RNA polymerase to the given template? 3…
Biology · NEET · NTA Exams — Molecular Basis of Inheritance
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3’TACATGGCAAATATCCATTCA5’
- 5’AUGUACCGUUUAUAGGUAAGU3’
- 5’AUGUAAAGUUUAUAGGUAAGU3’
- 5’AUGUACCGUUUAUAGGGAAGU3’
- 5’ATGTACCGTTTATAGGTAAGT3’
Answer
(A) 5 AUGUACCGUUUAUAGGUAAGU3
Sign up free on Edukali to view the step-by-step worked solution and practice thousands of similar questions.
Related practice questions
- Find the INCORRECT statements: Lactose directly binds to the operator to induce transcription. The i gene…
- Which is true about S strain and R strain of Bacterium Pneumococcus
- Given below are two statements. One is labelled as Assertion and the other is labelled as Reason. STATEMENT …
- Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R)…
- If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by…
- Given below are two statements: Statement I : RNA interference takes place in all Eukaryotic organisms as…
- Which may not be correct according to Chargaff's rule?
- Given below are two statements: Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA…
More Molecular Basis of Inheritance questions · Browse all practice questions