Molecular Basis of Inheritance — practice questions
111 curated practice questions from Molecular Basis of Inheritance (Biology NEET, NTA Exams) — 27 hard, 53 easy, 31 medium. Every question includes the final answer free; step-by-step worked solutions with a free account.
- Which one of the following is not a component of lac operon model?
- DNA synthesis can be estimated by incorporating radiolabeled:
- Find the INCORRECT statements: The promoter is located downstream of the structural gene. The template strand has the…
- In sea urchin DNA, which is double stranded, 17% of the bases were shown to be cytosine. The percentage of the other…
- In Griffith Experiment which statements are true S strain of Streptococcus pneumoniae killed Rat R strain of…
- Genetic transformation could not have occurred have if RNA was genetic material in pneumococcus. This is because
- Given below are two statements: Statement I : RNA interference takes place in all Eukaryotic organisms as method of…
- High mutation rate or alteration in DNA sequence is the result of:
- Probe used in elucidating specific sequences of DNA or RNA is
- Which enzyme was used by Avery, Macleod and McCarty in determining biochemical nature of genetic material
- Find the INCORRECT statements: Reverse transcription violates the central dogma. The central dogma states: DNA → RNA →…
- Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA…
- AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed…
- Escherichia coli cells with a mutation in lac Z gene of the lac operon can not grow in a medium containing only lactose…
- Which of the following is not required for any of the techniques of DNA fingerprinting available at present?
- In the process of transcription in Eukaryotes, the RNA polymerase I transcribes
- E.coli has only 4.6 10 6 base pairs and completes the process of replication within 38 minutes; then the average rate…
- Which one of the following pair is correctly matched with regard to the codon and the amino acid coded by it?
- Waston and Crick based their double helical structure of DNA on Xray diffraction study of DNA Chargaff's law Griffith…
- Find the INCORRECT statements: The i gene codes for beta-galactosidase. Lactose induces the lac operon by inactivating…
- Find the INCORRECT statements: Lactose directly binds to the operator to induce transcription. The i gene codes for an…
- Transcription takes place in:
- Which may not be correct according to Chargaff's rule?
- A molecule that can act as a genetic material must fulfill the traits given below, except
- Given below are two statements: Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of…
- If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of…
- The central dogma of molecular genetics states that the genetic information flows from:
- Which statement is correct regarding regulatory proteins action on RNA polymerase
- Which is the basis of genetic mapping of human genome as well as DNA finger printing?
- Promoters site and terminator site of transcription are located respectively at
- Which of the following is required as inducer(s) for the expression of Lac operon?
- Which of the following statements is not true about lactose operon
- Given below is a sample of a portion of DNA strand. What is specific about the sequence shown in it? array l…
- The drug streptomycin inhibits the process of [MP PMT 1996]
- In a bacterium, the amount of adenine was found to be 18 per cent. Suggest the cytosine base composition from the…
- If the sequence of bases in the DNA is TAGC, then the sequence of bases in mRNA will be:
- The enzyme peptidyl transferase involved in protein synthesis is a part of which type of rRNA?
- A probe which is a molecule used to locate homologous sequences in a mixture of DNA or RNA molecules could be [NCERT…
- Find the CORRECT statements: In prokaryotes, gene expression is primarily regulated at transcription initiation. The…
- DNA finger printing cannot be done for bacteriophage using DNA probes like VNTR as
- Given below are two statements: Statement I : Annealing stage of PCR is achieved by DNA primase enzyme. Statement II …
- Find the CORRECT statements: Satellite DNA shows high polymorphism. VNTRs are used as probes in DNA fingerprinting. DNA…
- Which enzyme/s will be produced in a cell in which there is a nonsense mutation in the lac Y gene?
- Silencing of a gene/specific mRNA translation could be achieved through the use of [NCERT; KCET 2018]
- Given below are two statements. One is labelled as Assertion and the other is labelled as Reason. STATEMENT - 1…
- Which of the following was used by Hershey and Chase to prove that DNA is the chemical basis of heredity [AIIMS 1993…
- Change of glutamic acid to valine causes sickle cell Anaemia which is the triplet code for valine
- Which step in transcription is catalysed by RNA polymerase
- Find the CORRECT statements: Griffith's experiment showed that heat-killed S strain bacteria transformed R strain…
- The technique of DNA finger printing was initially developed by:
- Which one of the following does not follow the central dogma of molecular biology?
- Given below are two statements: Statement I : Bright orange red bands of DNA appear in Southern Blotting. Statement II…
- Arrange the steps involved in DNA profilling in a sequence Isolation of DNA Separation of DNA fragments by…
- Given below are two statements: Statement I : In the lac operon, the z gene codes for beta-galactosidase which is…
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3 TACATGGCAAATATCCATTCA5
- Which statement regarding, gene expression through RNA is correct.
- The following ratio is generally constant for a given species:
- Given below are two statements. One is labelled as Assertion and the other is labelled as Reason. STATEMENT - 1…
- 15 N was not used in Hershey and chose experiment as
- Who proposed that the genetic code for amino acids should be made up of three nucleotides?
- A DNA nucleotide chain has AGCTTCGA sequence. The nucleotide sequence of other chain would be:
- PCR and Restriction Fragment Length Polymorphism (RFLP) are the methods employed in:
- Which is true about S strain and R strain of Bacterium Pneumococcus
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and…
- The term 'Nuclein' for the genetic material was used by:
- Which of the following are the post-transcriptional events in an eukaryotic cell? Transport of pre-mRNA to cytoplasm…
- Removal of introns and joining of exons in a defined order in a transcriptional unit is called:
- Given below are two statements. One is labelled as Assertion and the other is labelled as Reason. STATEMENT-1…
- Find the INCORRECT statements: Frameshift mutations occur due to insertion/deletion of three bases. Sickle cell anemia…
- What is the first step in the Southern blot technique?
- Given below are two statements: Assertion (A) : RNAi occurs in eukaryotic cells as a means of defense against viral…
- Semiconservative replication of DNA was first demonstrated in:
- Given below are two statements: Statement I: A point mutation always results in a change in the amino acid sequence of…
- The number of hydrogen bonds between adenine and thymine is:
- Which feature in DNA helix is attributed to purine pairing with pyrimidine through hydrogen bonds
- Given below are two statements: Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA. Statement II …
- Given below are two statements: Statement I : Regulation of Lac Operon by repressor is negative regulation. Statement…
- The beginning of understanding of genetic transformation in bacteria was made by:
- DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the:
- Meselson and Stahl's experiment on semiconservative replication was demonstrated by showing that DNA is _in 2nd…
- Types of RNA polymerase required in the nucleus for RNA synthesis:
- Find the INCORRECT statements: Polymorphisms must occur in coding DNA to impact evolution. DNA fingerprinting analyzes…
- Some viruses only have RNA but no DNA. This would indicate that:
- PCR and Restriction Fragment Length Polymorphism are the methods for [NCERT Pg. No. 172] [CBSE PMT (Pre.) 2012]
- Which one of the following pair of codon is correctly matched with their functions or the signal for the particular…
- Which of the following sequence is found in Rous sarcoma virus
- If a segment of a mRNA molecule has the sequence 5'-GUACCGAUCG-3', which of the following could have been the template…
- Transformation experiment was first performed on which bacterium?
- Gene regulation governing lactose operon of E. coli that involves the lac I gene product is:-
- Given below are two statements. One is labelled as Assertion and the other is labelled as Reason. STATEMENT - 1…
- The one aspect which is not a salient feature of genetic code, is its being:
- Given below are two statements. One is labelled as Assertion and the other is labelled as Reason. STATEMENT - 1…
- Given below are two statements: Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA. Statement II …
- From the following, identify the correct combination of salient features of Genetic Code
- The experimental proof for semiconservative replication of DNA was first shown in a
- Differentiation of organs and tissues in a developing organism, is associated with:
- Given below are two statements: Statement I : In eukaryotes three RNA polymerases in the nucleus in addition to the RNA…
- Select two correct statements, out of the four (1-4) statements given below about lac operon: This was elucidated by…
- Find the CORRECT statements: Both DNA strands are transcribed for a single gene. Introns are present in eukaryotic…
- Given below are two statements: Statement I : hnRNA is matured RNA in Bacteria which does not need further processing…
- Given below are two statements. One is labelled as Assertion and the other is labelled as Reason. STATEMENT - 1…
- Find the INCORRECT statements: RNA was the first genetic material. DNA evolved from RNA for greater stability. RNA…
- If the total amount of adenine and thymine in a double-stranded DNA is 45%, the amount of guanine in this DNA will be:
- Which one of the following triplet codes is correctly matched with the specificity for an amino acid in protein…
- Select the correct option:- In the First column is the direction of Template strand of DNA while in the second column…
- If sequences of bases in coding strand of DNA is 5'-TAGATCG - 3', then sequence of bases in RNA transcript will be
- Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A)…
- Given below are two statements: Statement I : Two successive nucleotides are linked in 3'-5' phosphodiester bonds…
- In E. coli, during lactose metabolism repressor protein binds to:
- The functional genetic unit of DNA is:
- Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A)…